Молекулярно генетические методы исследования презентация

Молекулярно-биологические исследования

Молекулярно генетические методы исследования презентация

Проведение полимеразной цепной реакции «в реальном времени» (Real Time PCR) является наиболее качественным и быстрым методом исследования. Метод ПЦР универсален – одна порция биологического материала позволяет провести исследования на наличие возбудителей целого ряда заболеваний.

Почему ПЦР диагностика обладает такой ценностью?

Одним из существенных преимуществ метода ПЦР является высокая чувствительность – от 95 до 100%.

ПЦР в диагностике инфекций

Преимущества метода ПЦР (чувствительность и специфичность) определяют широкий спектр применения в современной медицине.

Метод ПЦР автоматизирован и позволяет получить результаты анализа в течение одного рабочего дня.

ПЦР используется в акушерстве, гинекологии, неонатологии, педиатрии, урологии, венерологии, нефрологии, клинике инфекционных болезней, офтальмологии, неврологии, фтизиопульмонологии и др.

    Основные области применения ПЦР-диагностики:
  • 1. диагностика острых и хронических инфекционных заболеваний различной локализации
  • 2. контроль эффективности проведенной терапии
  • 3. уточнение вида возбудителя

Метод ПЦР позволяет проводить диагностику многих инфекционных заболеваний со сложной серологической картиной, определять «вирусную нагрузку» в крови пациента, выявлять дисбиоз урогенитального тракта у женщин и мужчин.

Основное направление – ДИАГНОСТИКА инфекций, передаваемых половым путем (ИППП).

Половым путем могут передаваться бактериальные (гонорея, хламидиоз, уреаплазмоз, микоплазмоз, гарднереллез), вирусные (герпес, цитомегаловирус, гепатит), протозойные (трихомониаз) и грибковые (кандидоз) инфекции.

Для быстрой, полной и недорогой диагностики инфекций, передаваемых половым путем, был разработан комплексный ПЦР анализ на 6, 10 и 11 основных возбудителей.

    Молекулярно-биологические исследования методом ПЦР«в реальном времени»:
  • Диагностика методом ПЦР «в реальном времени» бактериальной и вирусной инфекции урогенитального тракта;
  • Полное скрининговое исследование методом ПЦР на 11 инфекций (микоплазма хоминис, микоплазма гениталиум, уреаплазма уреалитикум/парвум, гарднерелла вагиналис, нейссерия гонорея, хламидия трахоматис, трихомонады, кандида альбиканс, цитомегаловирус, вирус простого герпеса, вирус Эпштейн-Барр);
  • Сокращенное скрининговое исследование методом ПЦР на 6 инфекций (микоплазма хоминис, микоплазма гениталиум, уреаплазма уреалитикум/парвум, гарднерелла вагиналис, хламидия трахоматис, трихомонады);
  • Скрининговое исследование методом ПЦР на 6 инфекций при ЛОР-заболеваниях (микоплазма хоминис, хламидия трахоматис, кандида альбиканс, цитомегаловирус, вирус простого герпеса, вирус Эпштейн-Барр);
  • Диагностика методом ПЦР «в реальном времени» вирусной инфекции в крови и тканях;
  • Диагностика методом ПЦР «в реальном времени» клинически значимого уровня папилломавирусной инфекции, и генотипирование;
  • Диагностика методом ПЦР «в реальном времени» вирусных гепатитов, их генотипирование (качественное и количественное определение);
  • Определение полиморфизма гена IL28B, ассоциированного с устойчивостью к терапии интерфероном и рибавирином у пациентов с гепатитом С, генотип 1Б. Выявление факторов, влияющих на успех лечения, в том числе генетических, имеет большое значение, как для врача, которому необходимы объективные критерии прогноза эффективности лечения, так и для пациента, который перед началом проведения стандартной терапии должен быть информирован о вероятности ее успеха и побочном действии используемых противовирусных препаратов. Определение генотипа пациента по IL28B поможет в принятии решения о применении стандартного курса терапии хронического гепатита С ПЕГ ИФН/РИБ и при необходимости индивидуальной оптимизации терапии за счет включения ингибиторов протеазы – телапревира и боцепревира.

    Молекулярно-генетические исследования методом ПЦР «в реальном времени» молекулярно-генетические исследования, которые выявляют предрасположенность к различным заболеваниям
  • Для здоровых, успешных людей, взявших за правило планировать жизнь и просчитывать все возможные риски, в том числе и риски, связанные со здоровьем.
  • Для заботливых родителей, желающих оценить риск тех или иных заболеваний у своих детей.
  • Для будущих мам, стремящихся свести к минимуму угрозы для нормального развития плода.
  • Для лиц, отягощенных наследственностью по онкологическим, сердечно-сосудистым и другим заболеваниям, желающим знать насколько велик риск этих заболеваний для них.

    Молекулярно-генетическая диагностика наследственной предрасположенности к широко распространенным заболеваниям (остеопорозу, заболеваниям, связанным с нарушением метаболизма кальция, ожирению, гипертонии, заболеваниям, связанным с нарушением фолатного цикла и с риском развития тромбофилии).
  • Основным направлением в работе лаборатории является исследование генетических факторов предрасположенности к тромбофилиям. Тромбофилия – патологическое состояние организма, характеризующееся повышенной склонностью к внутрисосудистому тромбообразованию вследствие врожденного, наследственного или приобретенного нарушения системы гемостаза, приводящего к утрате одной из ее основных функций – поддержания циркулирующей крови в жидком состоянии.

    Исследование генетической предрасположенности к тромбофилии показано в следующих случаях:
  • Наличие в анамнезе двух и более прерываний беременности на ранних сроках;
  • Наличие в анамнезе тяжёлых осложнений беременности (гестоз, задержка развития плода, внутриутробная гибель плода);
  • Наличие родственников с тромботическими проявлениями в возрасте до 50 лет (инфаркт миокарда, ОНМК, тромбоэмболия лёгочной артерии, тромбоз глубоких вен нижних конечностей и др.);
  • Несколько неудачных попыток ЭКО;
  • Повышение уровня антифосфолипидных антител и/или гомоцистеина;
  • Планирование гинекологических оперативных вмешательств;
  • Назначение оральных гормональных контрацептивов (ОК). Женщинам с эпизодом венозной тромбоэмболии, получающим оральные контрацептивы;
  • Назначение заместительной гормональной терапии. Женщинам с эпизодом венозной тромбоэмболии, получающим заместительную гормональную терапию;
  • Курящим мужчинам в возрасте до 50 лет с эпизодом венозной тромбоэмболии;
  • Наличие тромбофлебита.
    • Определение генетических полиморфизмов:
    • наследственной предрасположенности к гипертонической болезни,
    • генетической предрасположенности к гипертонической болезни и атеросклерозу,
    • генетической предрасположенности к ожирению с нарушением обмена липопротеинов,
    • нарушения метаболизма кальция,
    • наследственной предрасположенности к остеопорозу,
    • генетической предрасположенности к развитию рака молочной железы и яичников генов BRCA1 и BRCA2.

    График выдачи результатов молекулярно-биологических и цитогенетических исследовании

    ПЦР исследования на 2-4 рабочий деньТромбозы+ фолаты (код 73038), гипертоническая болезнь (код 73044), ожирение (код 74044Б) – 7 рабочих днейИнтерлейкин (код 73045)– выдача результатов каждый четвергМетаболизм кальция (код 7061) – 4 рабочих дняBRCA (код 73039) , остеопороз (код 74063), расширенная панель (73060) – 14 рабочих дней День забора материала не считаетсяЦитогенетические исследования выполняются в течение 14-18 рабочих дней

    Назад

    Социальные кнопки для Joomla

Источник: https://rokdc.ru/index.php/laboratornye-issledovaniya/75-informatsiya/laboratornye-issledovaniya/736-molekulyarno-biologicheskie-issledovaniya

Презентация на тему

Молекулярно генетические методы исследования презентация

  • Слайд 1 Ассистент кафедры лабораторной диагностики ИПО БГМУк.м.н. Билалов Ф.С.
  • Слайд 2 Геном – полный набор генов, содержащий весь объем информации, необходимой для развития организма, его существования в определенных условиях среды и передачи всех наследственных свойств в ряду поколений.ОБЪЕКТ ИССЛЕДОВАНИЯ: ГЕНОММолекулярная медицина Своевременное выявление предрасположенности к возникновению патологии
  • Слайд 3 Организация генома: составиструктура ДНК
  • Слайд 4 Организация генома: ДНК – хроматин – хромосома
  • Слайд 5 46, ХХ (жен.) или 46, ХУ (муж.) 22 пары аутосом 2 половые хромосомыГаплоидный набор (n)Диплоидный набор (2n)
  • Слайд 6 ГЕНОМИКАинструмент молекулярной медицинынаука, изучающая и «читающая» молекулярную структуру геномов живых организмов
  • Слайд 7 Проект «Геном человека» 1990-2003 г («двойная спираль» открыта в 1953 г.!) Идентификация 3 миллиардов нуклеотидов!!! Прочтены гены многих наследственных моногенных заболеваний Обнаружены естественныевариации генома – однонуклеотидные замены –полиморфизмы единичных нуклеотидов –SNP Создание карты SNP – до 600 000 вариацийОснова геномики – расшифровка генома человека
  • Слайд 8 МУТАЦИЯ? Естественные Вариации Генома???Моногенные болезни чаще всего вызваны мутацией одного гена – однонуклеотидными заменами. Для этих болезней характерно менделевское наследование – аутосомно-доминантное, аутосомно-рецессивное и Х-сцепленное. Муковисцидоз, Фенилкетонурия, Спинальные амиотрофии, Нейросиндромальная тугоухость
  • Слайд 9 Мутация–это изменение в последовательности нуклеотидов ДНК, встречающиеся в популяции с частотой менее 1% и приводящие к состоянию несовместимому с жизнью, либо ведущему к неэффективному функционированию генома (моногенные болезни). Полиморфизм– это «мутации», встречающиеся в популяции с частотой 2% и выше и проявляющиеся в фенотипе не столь очевидно,и не приводящие к заметным нарушениям функции гена.Мутации и естественные вариации генома – полиморфизмы
  • Слайд 10 МУТАЦИЯ Естественные Вариации ГеномаПОЛИМОРФИЗМ
  • Слайд 11

    Гены кодируют последовательность аминокислот в белках

  • Слайд 12 SNP – молекулярные свойства белка
  • Слайд 13 SNP – приводят к появлению белковых продуктов с незначительно измененными физико-химическими свойствами SNP – молекулярные свойства белка
  • Слайд 14 Конформация – 3D – формы молекул, которые могут динамически изменяться в пространстве.Аффинность -термодинамическая характеристика, количественно описывающая силу взаимодействия антигена и антитела или лиганда и рецептора.Связь с субстратом – величина, характеризующая прочность связи между ферментом и субстратом (насыщение химической реакции, обусловленная соотношением между концентрацией субстрата и скоростью реакции)Температурный оптимум активности ферментаВремя «жизни» молекулыПосттрансляционная модификация –достройка белковой молекулы углеводными, липидными и пр. молекулярными компонентами.Избыточный синтез белка – нарушение регуляцииSNP – молекулярные свойства белка
  • Слайд 15 Нормальный белокМУТАЦИЯ!!!-моногенное заболевание!!!ПолиморфизмКак это представить?
  • Слайд 16 НормаМУТАЦИЯ!!!-моногенное заболевание!!!ПолиморфизмКак это представить (по другому)?
  • Слайд 17 Как это увидеть?
  • Слайд 18 Сетчатка Мышцы Мозг СердцеЦвет глазГруппы кровиИзоферменты лактатдегидрогеназы
  • Слайд 19 Моногенные болезниНаследственностьОкружающая средаГеномика и болезни цивилизацииСахарный диабет , подагра , гипертоническая болезнь , ИБС, тромбофилии, язвенная болезнь, астма и онкопатология , нейродегенеративные заболевания, проблемы репродуктивного здоровья.
  • Слайд 20 Индивидуальный подходк человеку на основе его генетической уникальностипозволяет предсказывать:ГЕНОМИКАразвитие патологиии и проводить устранение опасных факторов окружающей среды до возникновения болезниособенности строения и жизнедеятельности организма
  • Слайд 21 Болезнь – любое патофизиологическое состояние, увеличивающее вероятность смерти.
  • Слайд 22 Cтепень взаимосвязи между наличием генетического фактора и риском развития заболевания. Величина OR указывает, во сколько раз риск данного заболевания выше у носителей данного генетического фактора, чем у лиц, не имеющих данного генетического фактора. Относительный риск (OR) и ГЕНОМИКА
  • Слайд 23 Белок, кодируемый геном участвует в патогенетическом пути развития заболеванияПолиморфный аллель изменяет структуру и/или функциональную активность белкаДостоверные ассоциации заболевания с данным генетическим вариантом показаны несколькими независимыми группами исследователей (+ метаанализ)
  • Слайд 24 У каждого двойной «комплект» генов
  • Слайд 25 CCGAAATTTTTCGTCCAGCATACGTACCACCGAAATTTTTCGTACAGCATACGTACCACCGAAATTTTTCGTTCAGCATACGTACCACCGAAATTTTTCGTGCAGCATACGTACCA АЛЛЕЛЬ (от греч. allelon – друг друга, взаимно) – различные формы одного и того же гена, расположенные в одинаковых локусах (участках) гомологичных (парных) хромосом, контролирующие один и тот же белок. Все гены любых клеток, за исключением генов, расположенных в половых хромосомах, представлено двумя аллелями, один из которых унаследован от отца, а другой – от матери.
  • Слайд 26 Полиморфизм генов и предрасположенность к мультифакторным заболеваниям: принципыРаспространенность SNP зависит от географии и этнической принадлежности.SNP – либо предрасполагают, либо препятствуют проявлению и развитию заболевания.Гены аллельные варианты которых содержат SNP и при наличии определенных условий (диета, экология, вредные привычки, образ жизни, лекарства) предрасполагают к определенным мультифакторным заболеваниям – гены предрасположенности.Сочетание аллельных вариантов генов с SNP, вовлеченных в развитие конкретной патологии – «генные сети». У гомозигот риск развития заболевания выше, чем у гетерозигот.
  • Слайд 27 Системы свёртывания крови и фибринолиза
  • Слайд 28 Сердечно-сосудистые заболевания – гипертензия
  • Слайд 29 Сердечно-сосудистые заболевания – нарушения липидного обмена
  • Слайд 30 Индивидуальное лекарство – подбор дозы варфарина (антикоагулянтов ряда кумарина)
  • Слайд 31 Полимеразная цепная реакция(ПЦР) -метод молекулярной диагностики, применяемый в клинической практике для обнаружения специфической НК возбудителя в исследуемом материале.
  • Слайд 32 ПЦР сопряженная с обратной транскрипциейГнездовая ПЦРПЦР in situКоличественная ПЦРМультипраймерная ПЦРАссиметричная ПЦРПЦР с «горячим стартом»Амплификация больших фрагментов ДНК с высокой точностьюАллель-специфическая ПЦРПЦР, чувствительная к метилированию матрицыИммуно-ПЦР
  • Слайд 33 Метод основан на многократном избирательном копировании определённого участка НК при помощи ферментов в искусственных условиях (in vitro).
  • Слайд 34 Выделение ДНК Амплификация ДНКДетекция ДНК
  • Слайд 35 -Преаналитический этапсбор, хранение, транспортировка- Выделение НКэкспресс-методы, универсальные методы- Сборка амплификационной смеси- Амплификация денатурация, отжиг, элонгацияДетекция электрофорез, конечная точка, real-time
  • Слайд 36 ЦелиПравильное определение информативного для ПЦР вида биологического материала. Сохранение ДНК возбудителя в материале до момента доставки в лабораторию. Препятствие попаданию в материал ингибиторов ПЦР-реакции. Предварительная очистка материала для облегчения выделения из него ДНК возбудителя.
  • Слайд 37 соскоб эпителиальных клетокмочасекрет простатыэякулятцельная венозная кровьмокротаспино-мозговая жидкость, выпоты, слюна и проч.Все, что содержит ДНК!
  • Слайд 38
  • Слайд 39 ГепаринСоли тяжелых металловСлизьКровь (гемоглобин)Некоторые лекарственные формыМочевая кислота и ее соединения
  • Слайд 40 Экспресс- методы (термический)
  • Слайд 41 Классический сорбентный методПреимущества: – чистота выделенной НК – универсальность использования Недостатки: – длительность – трудоемкость
  • Слайд 42
  • Слайд 43

    Результаты ПЦР на образцах с одинаковым количеством ДНК

  • Слайд 47 Отрицательный ответНК возбудителя не обнаруженоКонцентрация НК ниже 1000 ДНК-копий/млНеправильно выбран материал для исследованияПоложительный ответ- Присутствие НК возбудителя- Присутствие фрагментов НК возбудителя
  • Слайд 48 Прямое определение наличия возбудителей. Высокая специфичность. Высокая чувствительность. Универсальность процедуры выявления различных возбудителей. Высокая скорость получения результата анализа
  • Слайд 49 Спасибо за внимание!

Посмотреть все слайды

Источник: https://pptcloud.ru/raznoe/molekulyarno-geneticheskie-metody

Презентация на тему: Молекулярно-генетические методы диагностики

Молекулярно генетические методы исследования презентация

Выполнил: студент 2 курсаГруппы СТО17/201-3Прохорова к.с.

Изображение слайда

2

Слайд 2

Метод ПЦР   позволяет тестировать состояния генов у отдельных индивидуумов. Его суть заключается в избирательном копировании in vitro небольшого фрагмента гена, в котором предположительно может быть локализована мутация, с использованием в качестве матрицы  геномной  ДНК обследуемого.

Небольшие размеры копируемого (или амплифицируемого ) фрагмента гена в сочетании с их огромным числом позволяют в дальнейшем использовать очень простые методы для анализа этого участка ДНК, выявления его особенностей у обследуемого пациента.

Главными из этих методов являются электрофорез  амплифицированной ДНК, ее окрашивание, разрезание специфическими ферментами –  рестриктазами, и определение нуклеотидной последовательности этого фрагмента – секвенирование.

Изображение слайда

3

Слайд 3: Полимеразная цепная реакция (ПЦР)

Полимеразная цепная реакция (ПЦР)   или   специфическая амплификация ДНК   это избирательный синтез in vitro большого количества копий (порядка миллиона) небольшого фрагмента ДНК размером, обычно, в сотни нуклеотидов по матричной молекуле ДНК.

Для проведения ПЦР необходимо искусственно синтезировать небольшие однонитевые молекулы ДНК размером от 15 до 30 нуклеотидов, комплементарные концам амплифицируемого фрагмента ДНК. Эти молекулы носят название  праймеры. Они служат «затравкой» для синтеза ДНК и потому определяют его специфичность.

ПЦР проводится в специальных одноразовых  пробирках в очень небольшом объеме, не превышающем, обычно, 50 мкл.

В этот объем определенного буфера добавляют матричную ДНК (ДНК обследуемого), два типа искусственно синтезированных на коммерческой основе праймеров, фермент комплементарного синтеза ДНК – термофильную ДНК-полимеразу,  выделенную из термофильных бактерий и потому способную выдерживать высокие температуры, и 4 типа дезокситрифосфатов ( dNTP ), которые служат в качестве строительного материала для синтеза ДНК.

Изображение слайда

4

Слайд 4

Изображение слайда

Изображение для работы со слайдом

5

Слайд 5

Изображение слайда

Изображение для работы со слайдом

6

Слайд 6

Изображение слайда

Изображение для работы со слайдом

7

Слайд 7

Изображение слайда

Изображение для работы со слайдом

Реклама. Продолжение ниже

8

Слайд 8

Изображение слайда

Изображение для работы со слайдом

9

Слайд 9

Изображение слайда

Изображение для работы со слайдом

10

Слайд 10

Изображение слайда

Изображение для работы со слайдом

11

Слайд 11

Изображение слайда

Изображение для работы со слайдом

12

Слайд 12

Изображение слайда

Изображение для работы со слайдом

13

Слайд 13

Изображение слайда

Изображение для работы со слайдом

14

Слайд 14

Изображение слайда

Изображение для работы со слайдом

Реклама. Продолжение ниже

15

Слайд 15: Электрофорез ДНК

Электрофорез ДНК  принципиально не отличается от белкового электрофореза. Амплифицированную ДНК наносят на полиакриломидный или агарозный гель и включают ток. При этом начинается продвижение ДНК в геле от минуса к плюсу, и скорость этого продвижения зависит от длины молекулы и ее конфигурации.

Через определенное время молекулы ДНК одинаковой длины сконцентрируются в узких зонах. Количество копий синтезированных в процессе проведения ПЦР ДНК, обычно, бывает достаточным для ее визуализации при использовании рутинного метода окрашивания ДНК этидиумом бромидом.

При добавлении этого красителя к гелю полосы ДНК высвечиваются красным цветом при просмотре геля под ультрафиолетовой лампой.

Изображение слайда

16

Слайд 16

Молекулярная диагностика точковых мутаций миссенс – или нонсенс-типа  более сложна, так как длина амплифицированного фрагмента при этом не меняется. Наиболее распространенным методом диагностики таких мутаций является метод  рестрикционного анализа.

Этот метод может быть использован только в тех случаях, когда мутации случайным образом изменяют последовательности, специфичные для узнавания рестриктазами – эндонуклеазами, катализирующими разрезание двунитевых последовательностей ДНК в местах локализации этих специфических сайтов.

  При наличии в норме сайта рестрикции произойдет разрезание амплифицированного фрагмента и на электрофореграмме будет две полосы, соответствующие фрагментам ДНК, суммарная длина которых равна величине  исходного амплифицированного фрагмента.

Исчезновение сайта рестрикции в результате мутации приведет к тому, что у мутантных гомозигот разрезания амплифицированного фрагмента не произойдет и на электрофореграмме будет одна полоса, причем характер ее расположения будет аналогичен тому, который можно наблюдать после электрофореза до рестрикции.

У гетерозигот выявятся все три полосы, одна из которых соответствует неразрезанному амплифицированному фрагменту, а две – продуктам рестрикции. В настоящее время идентифицировано более 500 различных рестриктаз, и для каждого из этих ферментов существует свой сайт узнавания.

Изображение слайда

17

Слайд 17

Универсальным методом диагностики точковых мутаций является метод   аллель-специфических олигонуклеотидов (АСО). Этот метод основан на гибридизации амплифицированных ДНК со специфическими  олигонуклеотидными   ДНК-зондами. Он более трудоемок, так как требует синтеза и специфического мечения ДНК-зондов.

Однако этот метод поддается автоматизации, и на его базе разрабатываются технологии, позволяющие одновременно тестировать десятки или даже сотни мутаций.

При этом используются микрочиповые технологии, то есть меченные олигонуклеотиды в микроколичестве наносятся на твердые носители (чипы), а затем проводится их гибридизация с исследуемыми образцами ДНК.

Сходная технология –   « микроэррей »  –    используется для анализа  экспрессионного профиля генов, то есть множества генов, избирательно экспрессирующихся в специфических тканях или клетках, у  пациентов с определенными патологическими состояниями, различающихся по возрасту, этнической принадлежности и другим параметрам.

Техника  « микроэррей »  позволяет одновременно анализировать экспрессию десятков тысяч генов.Секвенирование ДНК   является самым объективным методом регистрации мутаций, при котором точно идентифицируется молекулярный характер повреждения. Однако в клинической практике этот метод используются редко в виду его трудоемкости и высокой стоимости.

Изображение слайда

18

Последний слайд презентации: Молекулярно-генетические методы диагностики

Экспресс-методы — это быстрые предварительные методы изучения генетики человека. Они часто используются для исследования больших контингентов людей с целью выявления наследственной патологии как скрининг-методы, применяемые при проведении просеивающих программ.

Например, скрининг новорожденных на фенилкетонурию, гипотиреоз, беременных на альфа- фетопротеин, при помощи которого можно пренаталь -но определить у плода некоторые пороки развития (например, анэнцефалию, открытые формы спинномозговых грыж, синдром Дауна ).

К этим методам предъявляются определенные требования:1) метод должен быть диагностически значимым, то есть положительные и отрицательные результаты должны соответствовать наличию или отсутствию заболевания;2) метод должен быть надежным: один и тот же образец при независимой двукратной проверке должен одинаково оцениваться;3) исследованию должен подвергаться легкодоступный материал (кровь, моча) в малых количествах (например, пятна капиллярной крови, высушенной на фильтровальной бумаге);4) метод должен быть приемлемым для обследуемых, исполнителей и врачей;5) метод должен быть экономичным.

Изображение слайда

Источник: https://slide-share.ru/molekulyarno-geneticheskie-metodi-diagnostiki-221558

Медицина и здоровье
Добавить комментарий

;-) :| :x :twisted: :smile: :shock: :sad: :roll: :razz: :oops: :o :mrgreen: :lol: :idea: :grin: :evil: :cry: :cool: :arrow: :???: :?: :!: